To design pan-eukaryote “outer” nested primers, Geneious software (Biomatters Inc, Newark, NJ, USA) was used to align the 18S rRNA genes from publicly available sequences of 29 species of protozoa, 30 species of helminths, and Homo sapiens. A list of these sequences is provided in Supplementary File S1, Appendix A. The PCR1 (outer) primer sequences are as follows: TTGATCCTGCCAGTAGTCATATGC (outer forward) and GGTGTGTACAAAGGGCAGG GAC (outer reverse), generating a PCR product of approximately 2 kb. Inner primers for the universal nested PCR were identical to those previously described by Flaherty et al. [18], with primer sequences as follows: CCGGAGAGGGAGCCTGAGA (inner forward) and GAGCTGGAATTACCGCGG (inner reverse), generating a PCR product of approximately 200 bp. Primers were synthesized at the CDC Biotechnology Core Facility.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.