H9c2 cells were transfected with Ndufv1, Ndufv2, Ndufs1, Ndufs4, Ndufs6, or Ndufa12 siRNA (GenePharma, Shanghai, China). The siRNA sequences were listed in Table S2. At 48 h post-transfection, the cells were subjected to hypoxia and reoxygenation, and ROS production and cell viability were determined.

Ndi1 plasmid was obtained from Genomeditech Biotechnology (Shanghai, China). Yeast genomic DNA was extracted from wild type Saccharomyces cerevisiae using a yeast DNA extraction kit. The Ndi1 gene was PCR-amplified from yeast genomic DNA using primers (F: 5′ TGTAAAACGACGGCCAGT 3′ and R: 5′ CCGCTCGAGTAATCCTTTAAAAAAGTCTCTTTTGAAAAATGCTAATTTAATCC 3′). After digestion with EcoRI and XhoI, PCR products were ligated into the PGMLV-CMV-MCS-3*flag-EF1-ZsGreen1 vector and confirmed by DNA sequencing. The Ndi1 plasmids were then purified using Plasmid DNA Purification Kit (QIAGEN, Germany). Transfection efficiency was determined by Western blot with anti-Flag antibody (20311007, Bioworld Technology Co., Ltd., MN, USA). Then, OCR was measured in H9c2 cells treated with ginsenoside Rb1. The transfected cells were also subjected to hypoxia and reoxygenation or succinate treatment and ROS production was evaluated.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.