A conditional point mutant allele of the Mdm2 gene (Ensembl ID: ENSMUSG00000020184 in Genome Assembly GRCm38.p6) was generated by gene targeting. This allele replaces exons 11 and 12 (ENSMUSE00001296149 & ENSMUSE00000665547) of the mouse Mdm2 gene transcript (Ensembl transcript ID: Mdm2-201; ENSMUST00000020408.15) with an alternate version of exons 11 and 12 encoding the I438K point mutation upon Cre recombination. This changes the ATC codon at positions 418–420 of Mdm2 exon12 to AAG, replacing the isoleucine at position 438 with lysine.

An F3-Neomycin-R cassette was inserted into the Mdm2 targeting vector by cotransfection of EL250 E. coli (Liu et al. 2003). These E.coli can express Flp recombinase under arabinose induction. The DNA fragment flanked by the homology arms was excised and recombineered (Liu et al. 2003) into a pool of mouse genomic DNA BAC clones (Source Biosciences) carrying the mouse Mdm2 gene in EL350 E.coli (Adams et al. 2005). A retrieval plasmid was generated by the PCR amplification of NotI-AscI linearized pFlexDTA (a modified version of pFlexible; [van der Weyden et al. 2005]). The modified sequences were retrieved from BAC clones in EL250 E.coli by recombineering.

The targeting vector was sequence verified prior to transfection. It was then linearized by AscI digestion and used to transfect HM1 mESCs by electroporation (Magin et al. 1992). Cells were selected under neomycin (300 µg/mL) and surviving colonies were picked and screened for targeting by long range PCR (using the Roche Expand long template PCR system) from within the neomycin-resistance cassette to sequences beyond the ends of the homology arms. Oligo sequences used to screen cells to ensure appropriate targeting of the Mdm2 gene were GTGGATTGATTTAGGAAACAAGATG and CAAGTTAACAACAACAATTGCATTC for the 5′ side and GCATTGTCTGAGTAGGTGTCATTC and ACGCAACATTAATACAAAGCTATCC for the 3′ side.

Following identification of correctly targeted clones, mouse lines were derived by injection of ES cells into C57BL/6J blastocysts according to standard protocols (Nagy et al. 2003). After breeding of chimeras, germline offspring were identified by coat color and the presence of the modified allele was confirmed with the primers described above. The point mutation and recombination sites were sequence verified in the mice. Mice carrying the tm1.1 allele were generated by crossing mice harboring the tm1 allele with a mouse line expressing Flpe (Tg(ACTFLPe)9205Dym) to delete the selectable marker by recombination at the FRT sites (Rodríguez et al. 2000). Deletion of the selectable marker was confirmed by PCR across the remaining F3 site.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.