Mitochondrial DNA was isolated using Qiagen Blood and Tissue Kit following the manufacturer’s protocol (Qiagen). Primers for mitochondria D-loop (encoded by mitochondrial DNA) and Ikb-β (encoded by nuclear DNA) were utilized to determine relative mitochondrial DNA level, and β-actin was used as an internal control; primers are shown in the format of gene, forward primer (F), reverse primer (R): mtD-loop, (F) ACTATCCCCTTCCCCATTTG, (R) TGTTGGTCATGGGCTGATTA; Ikb-β, (F) GCTGGTGTCTGGGGTACAGT, (R) ATCCTTGGGGAGGCATCTAC; β-actin, (F) TGTTACCAACTGGGACGACA, (R) ACCAGAGGCATACAGGGACA.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.