CRISPRa assay was conducted using the SAM system (http://sam.genome-engineering.org/protocols/). The sgRNA for hLMR1 was designed using the following sequence: forward, CACCGGACAGACAGGAGAGCAGACT; reverse, AAACAGTCTGCTCTCCTGTCTGTCC. Briefly, the template was ligated into the sgRNA (MS2) cloning backbone (Addgene, 61424) using Golden-Gate reaction (SAM) after Golden-Gate annealing. The expression cassettes of dCas9-VP64 (Addgene, 61422) and MS2-P65-HSF1 (Addgene, 61423) were subcloned into pAdv5 vector (Invitrogen) for virus packaging. SgRNA elements with the U6 promoter were amplified and subsequently cloned into pAd/PL adenovirus vector (Invitrogen) for virus packaging. Viruses were amplified, desalted, and titered as described above. Three adenoviruses (1:1:1) were delivered into humanized mice intravenously at a total of 5 × 108 PFU/mouse. After 7 days, tissue samples were harvested for further analysis after mice were under food withdrawal for around 5 hours (from ~9:00 am to 2:00 pm).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.