Cell lines, cDNA clones, siRNAs, shRNAs, and reagents.
This protocol is extracted from research article:
CLIC1 recruits PIP5K1A/C to induce cell-matrix adhesions for tumor metastasis
J Clin Invest, Jan 4, 2021; DOI: 10.1172/JCI133525

We used Huh7, Hep3B, Mahlavu, and HepG2 (human hepatoma cell lines); SK-Hep1 (a human hepatic adenocarcinoma cell line); and 2 primary HCC cell lines, LT87 and PDX57, which were derived from 2 patients with HCC, in this study. For immunoprecipitation assays, we used human 293T cells because of their high efficiency in the expression of transduced clones. The cells were cultured in DMEM (Thermo Fisher Scientific) with 10% FBS. Plasmid pCLIC1-GFP was from Origene (#RG218042), and plasmids pPIP5K1A-Myc (#20580), pPIP5K1C-GFP (#22299), and PLC-delta-GFP were from Addgene (#21179). The PIP5K1A cDNA, which was cloned into pCMV6-Myc, was from Addgene (#20580). pEGFP-C2-PIP5K1C90 was from Addgene (#22299). The target sequences of siRNA or shRNA for CLIC1 were TGGCTCAAGGAGTCACCTTCAATG and CCCATTCCTGCTGTATGGCACTGAA (Thermo Fisher Scientific). The MQAE staining reagent was from Thermo Fisher (catalog E3101). R(+)-IAA-94 was purchased from MilliporeSigma (catalog I117). Pseudolentivirus for shRNAs targeting CLIC1 mRNA (shCLIC1), luciferase (shLuc), or an empty vector (shEV) were obtained from National RNAi Core. Overexpression of CLIC1 was performed using the Lenti-X Tet-Off Advanced Inducible expression system (632163; Clontech) according to the manufacturer’s instructions.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.