Cell culture, lentiviral and retroviral infections
This protocol is extracted from research article:
Novel Functions of CD147 in the Mitochondria Exacerbates Melanoma Metastasis
Int J Biol Sci, Jan 1, 2021; DOI: 10.7150/ijbs.52043

The human melanoma cell lines SK-MEL-5, SK-MEL-28, A375, G361, MM200 and 293T were maintained in our lab (All cell lines have been identified by professional companies). They were all cultured in DMEM (Bioind, Israel) supplemented with 10% fetal bovine serum (Bioind, Israel). The cell lines were cultured in humidified 37 °C incubators supplemented with 5% CO2. Lentiviruses carrying shRNA were generated by transfecting 293T cells with 4 μg of lentiviral vectors encoding shRNA, 3 μg of psPAX2, and 1 μg of pMD2G using Lipofectamine 2000 (Invitrogen). Forty-eight and seventy-two hours after transfection, supernatants containing lentiviruses were collected. Eight hours after infection, the cells were incubated with puromycin (2 μg/ml) for 48 h. The sequence of shRNA was CCGGGCTACACATTGAGAACCTGAACTCGAGTTCAGGTTCTCAATGTGTAGCTTTTT.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.