Total RNA was extracted from cells or samples by using TRIzol reagent (Takara, Shiga, Japan). Real-time PCR was performed using SYBR-Green master mix (Takara) and products were detected by StepOne Plus system (Applied Biosystems, Foster City, CA). GAPDH was served as an endogenous control. The primers sequences are listed as follows: NETO2 forward: AGATGGGCCATTTGGTTTCTC; NETO2 reverse: TGCTCGAAATCCCAGTCCTTC; Nrf2 forward: TCAGCGACGGAAAGAGTATGA; Nrf2 Reverse: CCACTGGTTTCTGACTGGATGT.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.