ERG fusion detections were performed by polymerase chain reaction PCR. cDNA was generated using SuperScript IV One-Step RT-PCR System (Applied Biosystems TM, USA). PCR was performed with the primers F: GCTCCTATCACGCCCACCCA and R: TCCTTCCCCAGCCCCAGTAAA to estimate the expression of the ERG gene. As contrast, the expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase were detected with primers F: TGCACCACCAACTGCTTAGC, R: GGCATGGACTGTGGTCATGAG. Samples with ERG expression were selected to determine if any samples contained any of the known 5 types of breakpoints for TMPRSS2-ERG fusions. The primers for detection of each breakpoint are listed in Supplementary Table S1.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.