Stable transfectants were obtained from the JEG3 cell line, including a negative control line (NC) using an empty lentivirus CRISPR/Cas v2 vector with the puromycin resistance gene and a ChSy-2 knockout line (ChSy-2-/-) using a plasmid inserting a gRNA of GCCGCGCGGCAACACCAACG (according to online resources at the Zhang Lab website: https://zlab.bio/guide-design-resources) into a vector for targeting exon 1 of ChSy-2 in the coding sequence (AB175496.1).

Plasmid transfection was performed with Lipofectamine® 3000 Reagent (cat. no. L3000008; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions when the cultured cells reached approximately 70% confluence. The transfected JEG3 cells were screened in medium containing 4 μg/ml puromycin (cat. no. anti-Pr-1, InvivoGen) for 1 week. The cells were isolated, amplified and maintained in 2 μg/ml puromycin for subsequent experiments.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.