The pLenti-EF1α-Cas9-FLAG-IRES-Neo vector (a gift from S. McBrayer, Kaelin Laboratory) was used to generate Cas9-expressing cells. pLenti-EF1α-Cas9-FLAG-IRES-Neo was created by PCR amplification of the cDNA from lentiCRISPR v2 (Addgene, no. 52961) encoding Cas9 with a terminal Flag epitope tag with a 5′ primer that introduced an Eco RI restriction enzyme site and a 3′ primer that introduced a Not I restriction enzyme site. This PCR product was digested with Eco RI and Not I, gel-purified, and ligated to pLenti-EF1α-IRES-Neo vector (a gift from G. Lu, Kaelin Laboratory alumnus) that was restricted with these two enzymes.

The pLX304-gate-IRES-GFP and pLX304-gate-IRES-Tdtomato destination vectors were made by V. Koduri as previously described (41). The pDONR223-VHL, pDONR223-EV, and pDONR223-VHLΔB entry clones were gifts from A. Chakraborty (Kaelin Laboratory) and were used in Gateway cloning reactions to move the EV stuffer DNA insert into the pLX304-gate-IRES-GFP destination vector and to move the VHL and VHLΔB (deletion of amino acids 91 to 121) cDNAs into the pLX304-gate-IRES-GFP and pLX304-gate-IRES-Tdtomato destination vectors by homologous recombination using LR Clonase II (Life Technologies, no. 11791100) at room temperature for 1 hour per the manufacturer’s instructions. A 3-μl aliquot of each recombination reaction was then transformed into 50-μl HB101 competent cells (Promega, no. L2011). Plasmids from ampicillin-resistant colonies were isolated by the QIAprep Spin Plasmid Miniprep Kit (Qiagen, no. 27106) and validated by DNA sequencing. The EV insert is 5′-TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCGAATTCGCGGCCGCACTCGAGATATCTAGACCCAGCTTTCTTGTA-3′.

The pLenti-CDK6-D104S lentiviral vector was made by Gateway cloning the pDONR223-CDK6-D104S entry clone (a gift from N. Persky, Broad Institute) into the pLenti-EF1α-gate-3HA-PGK-Puromycin destination vector (a gift from G. Lu, Kaelin Laboratory alumnus) as described above.

The pLL3.7-EF1α-Fluc-Neo vector (a gift from M. Oser, Kaelin Laboratory) was used to generate Fluc-expressing cells. pLL3.7-EF1α-Fluc-Neo was created by PCR amplification of the firefly luciferase cDNA from Luc.Cre EV (Addgene, no. 20905) with a 5′ primer that introduced an Xba I restriction enzyme site and a 3′ primer that introduced a Not I restriction enzyme site. This PCR product was digested with Xba I and Not I, gel-purified, and ligated to a modified pLL3.7 lentiviral expression vector containing the EF1α promoter and a neomycin resistance gene (a gift from S. McBrayer, Kaelin Laboratory) that was restricted with these two enzymes.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.