DNA extraction was performed with the KAPA Mouse Genotyping Kit (Sigma-Aldrich). Eighty-eight microliters of water, 10 μl of KAPA express extract buffer, and 2 μl of KAPA express extract enzyme were mixed and placed on the Eppendorf containing a small piece of biopsy. Lysis was performed on thermocycler for 10 min at 75°C for lysis and 5 min at 95°C for enzyme inactivation. The mix reaction for PCR was composed of 14.5 μl of H2O, 5 μl of 5× buffer (Promega), 1.5 μl of MgCl2 (25 mM; Promega), 1.25 μl of primers, 0.25 μl of deoxynucleoside triphosphate (25 mM), and 0.25 μl of GoTaq polymerase (Promega) for 1 μl of lysis product. The following primers were used: 93598cof-KKA1, AGACAAGGGTTCATGTAACAGACTCGCC; 93599cof-KKA1, GTGGTTCGCCTATGGGATCTGCTACTC.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.