Total RNA was isolated using the RNeasy Extraction Kit (Qiagen). To quantify Myc expression levels, equal amounts of cDNA were synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) and mixed with the Power SYBR Green PCR master mix (Applied Biosystems, Carlsbad, CA) and 5 pmol of both forward and reverse primers. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified as an internal control. The sequences of the human primers used for quantitative polymerase chain reaction (qPCR), listed from 5′ to 3′, were as follows: MYC, CCTACCCTCTCAACGACAGC (forward) and CTCTGACCTTTTGCCAGGAG (reverse); ACTB (β-actin), AATCTGGCACCACACCTTCTAC (forward) and ATAGCACAGCCTGGATAGCAAC (reverse).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.