Genomic DNA was isolated from pNK cells with the DNeasy Blood and Tissue Kit (Qiagen). Exons 1, 4, and 5 of KIR2DL1 were amplified using the primers described by Norman et al. (61) for KIR2DL1 (table S2). The following conditions were used for PCR using ThermoPol Taq (New England Biolabs): 95°C for 30 s; 95°C for 15 s, 10 cycles of 65°C for 60s; 20 cycles of 95°C for 20 s, 61°C for 50 s, and 68°C for 30 s; and 68°C for 5 min. Sanger sequencing with the same primers was used to determine the presence of specific KIR alleles (GATC Biotech). RNA was isolated from pNK clones with the RNeasy Mini Kit (Qiagen) with deoxyribonuclease treatment (Qiagen) and converted to cDNA with the High-Capacity RNA-to-cDNA Kit (Applied Biosystems). The primers listed in table S3, which were adapted from Shilling et al. (62), were used on cDNA from pNK clones to discriminate between alleles identified in the genomic DNA. qPCR was analyzed by the ΔΔCT (cycle threshold) method and normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward primer: GAAGGTGAAGGTCGGAGT; reverse primer: CATGGGTGGAATCATATTGGAA).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.