At least 5 × 106 cells were used per chromatin immunoprecipitation (ChIP) using the CST SimpleChIP kit (CST #9003) and following the manufacturer’s protocol. Anti-RORγt (clone H-190; Santa Cruz Biotechnology #Sc-28559x) was used at 2 μg per ChIP, and rabbit isotype immunoglobulin G control (provided with CST SimpleChIP kit) was used at the same concentration. The following primers were used to amplify RORγt-bound DNA at Btla gene: −49 site: CACCAGGTCTCCTGATTTGA (forward) and AGGAGTCCCAAGCATGGCA (reverse); −369 site, GGTTGTAAGATACATTACACTG (forward) and TCTAAATTGTTACAGTCTTTAGG (reverse). The following primers were used to amplify RORγt-bound DNA at Il17a gene promoter: CTGAAGAGCTGGGACCTAATG (forward) and GCTCTCTCATGTTCTCTCCTCTC (reverse); CNS-5 site, CCGTTTAGACTTGAAACCCAGTC (forward) and GTACCTATGTGTTAGGAGGCGC (reverse).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.