TsA-201 HEK cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS (fetal bovine serum), l-glutamine, and penicillin/streptomycin at 37°C in 5% CO2. Plasmids were transfected using calcium phosphate as previously described (67) or Lipofectamine 2000 for the BRET assay (14). The pERK assay was done using 1 μg of rat TRPV1 plasmid transfected in a 35-mm dish. Experiments were performed 24 to 48 hours after transfection. For electrophysiology experiments using the β-arrestin2 CRISPR cell line, gene deletion was achieved by using published CRISPR guide RNAs (GAAGTCGAGCCCTAACTGCA and GCGGGACTTCGTAGATCACC) (68) cloned into the lentiCRISPR V2 vector (Addgene plasmid no. 52961). HEK cells were transfected with CRISPR vectors using Lipofectamine LTX (Invitrogen), and cells were selected with puromycin (2.5 μg/ml). Successful β-arrestin2 knockdown was confirmed by Western blotting analysis.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.