Two-month-old C57bl/6 mice were obtained from Jackson Laboratories (Bar Harbor, ME). All mice were housed with a 12-hour light/12-hour dark cycle and under standard conditions with drinking water and food available ad libitum. All experiments were conducted on age-matched animals, under protocols approved by the University of Calgary Animal Care Committee and in accordance with the international guidelines for the ethical use of animals in research and guidelines of the Canadian Council on Animal Care. TRPV1−/− mice (strain B6.129X1-Trpv1tm1Jul/J) were originally obtained from the Jackson Laboratories and bred at the University of Calgary Animal Resource Center. Mice were genotyped with the following primers: WT, cctgctcaacatgctcattg [984 base pairs (bp)]; heterozygotes, tcctcatgcacttcaggaaa (450 and 984 bp); and TRPV1−/−, tggatgtggaatgtgtgcgag (450 bp; Jackson Laboratories). Transgenic Ai32/TRPV1-cre mice were bred in the University of Calgary Animal Resource Center (G. W. Zamponi) by crossing mice homozygous for the Rosa-CAG-LSL-ChR2 (H134R)-EYFP-WPRE conditional allele (loxP-flanked STOP cassette) [strain B6;129S-Gt(ROSA)26Sortm32(CAG − COP4*H134R/EYFP)Hze/J; hereafter Ai32] with mice expressing Cre recombinase in TRPV1 cells [strain B6.129-Trpv1tm1(cre)Bbm/J; hereafter TRPV1-cre] (both from the Jackson Laboratories).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.