About 40 × 106 BMDMs were used per condition. After simulation with LPS, cells were directly fixed with 1% formaldehyde and incubated at room temperature for 10 min. Cross-linking was quenched by adding freshly prepared glycine in PBS to a final concentration of 0.125 M and let sit for 5 min at room temperature. Plates were washed twice with cold PBS and were scraped into a 50-ml conical tube using cell scrapers. Collected cells were spun and resuspended in 0.5 ml of SDS lysis buffer [1% SDS, 10 mM EDTA, and 50 mM tris (pH 8.0)] with 1× protease inhibitors (Sigma-Aldrich, catalog no. S8830). Cells were sonicated using a Virtis Virsonic 600 with a microtip and the following settings: total process time, 5 min; pulse on, 0.5 s; pulse off, 0.5 s; output, 1. Chromatin was stored overnight (O/N) at −80°C and thawed the following day on ice. Samples were centrifuged for 15 min, with a maximum speed at 4°C in a tabletop centrifuge, and supernatant was taken for quantification on a NanoDrop 8000. Chromatin (100 μg) was used per immunoprecipitation (IP) in a total volume of 300 μl in ChIP dilution buffer (16.7 mM tris-HCl, 167 mM NaCl, 1.2 mM EDTA, 0.01% SDS, and 1.1% Triton X-100) with protease inhibitors. After this, the appropriate antibodies were added to each IP, 10 μg of anti-NFIL3 (Santa Cruz Biotechnology, catalog no. sc-9550x), 8 μg of anti-FLAG (Sigma-Aldrich, catalog no. F7425), and samples were rotated overnight at 4°C. To pull down immune complexes, 50 μl of Protein G Agarose/Salmon Sperm DNA (EMD Millipore) was added per IP and rotated 2 hours at 4°C. Fifteen microliters of supernatant from no-antibody control samples was saved as 5% input. Samples were washed in the following sequence: 1× with 1 ml of low-salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM tris-HCl (pH 8.1), and 150 mM NaCl], 1× with 1 ml of high-salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM tris-HCl (pH 8.1), and 500 mM NaCl], 1× with LiCl1 wash buffer [0.25 M LiCl, 1% IGEPAL CA-630, 1% deoxycholic acid (sodium salt), 1 mM EDTA, 10 mM tris (pH 8.1)], and 2× with 1-ml tris-EDTA (TE) (pH 8.0). All washes were done with ice-cold buffer at 4°C with rotation, except TE washes that were done at room temperature. After washes, samples and inputs were resuspended in 300-μl SDS lysis buffer with 1-μl Proteinase K (20 μg/μl) and incubated for 2 hours at 55°C to digest proteins. Samples were reverse–cross-linked by incubating overnight at 65°C. Immunoprecipitated DNA was purified with the Qiagen PCR purification kit, and samples were eluted in 200 μl of water. RT-qPCR was performed as described in the section “RNA isolation, reverse transcription, and RT-qPCR.” ChIP primers were as follows: Il12b enhancer, TTCACCAGTGACTCCAGCAG (forward) and AGGACCATGGCTGGTACAAC (reverse); Il12b promoter, GGGGAGGGAGGAACTTCTTA (forward) and CTTTCTGATGGAAACCCAAAG (reverse); and negative control, AGCTGTGTAGGGACACATATTGAG (forward) and CACACAAACTCTTAGTCCAGTTCC (reverse).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.