Mutant CNBP and hnRNPH1 constructs were generated using a KOD Hot Start DNA Polymerase kit (Merck Millipore) and further confirmed by DNA sequencing. All mutations were carried in the context of full-length CNBP (UniProtKB; P62633) and hnRNPH1 (UniProt; P31943). The full sequence of hnRNPH1 was cloned into pMX-IRES-blasticidin overexpression retroviral vector (Cell Biolabs, #RTV-016, a gift from Kaldis Lab). The mutagenesis of the residues R217K and R224K was generated using a KOD Hot Start DNA Polymerase kit (Merck Millipore) and further confirmed by DNA sequencing. Retroviral particles were produced using Phoenix-AMPHO (ATCC CRL-3213) packaging cell line as previously described (10). Likewise, lentiviral particles for hnRNPH1 knockdown were similarly produced using the plasmid pLKO_TRC005 TRCN0000236086 (Sigma-Aldrich), targeting the 3′ untranslated region sequence TTGCCCTTTGCCACGTTAAAT. HeLa cells were transduced for 48 hours with concentrated virus for hnRNPH1 overexpression and subsequently selected with blasticidin (20 μg/ml) for 48 hours. Cells were then transduced with the lentiviral particles for knockdown. After 48 hours, cells were selected with puromycin (1 μg/ml) for 24 hours and counted with trypan blue after 2 days. The following primers were used for quantitative polymerase chain reaction validation of knockdown and overexpression: endogenous hnRNPH1, AGCAGCATGAGTGGATACGA (forward) and GCTAGACAACCCTCCCAT (reverse); overall hnRNPH1, GTGGAGAGGGATTCGTGGT (forward) and GGTCTGCCTTCTCTGGTGT (reverse). To statistically analyze these knockdown data in fig. S4D, generalized linear models with gamma distribution were performed to test the change in ratios. P values of less than 0.05 were considered to indicate statistical significance. These tests, and all statistical analyses, were performed using SAS software, version 9.4 (SAS Institute, Cary, NC).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.