To maximize the effect of gene disruption, gRNA sequences near exon 2 and exon 3 of the mouse Pkd2 genomic DNA were used. Pkd2 single guide RNA (sgRNAs) were designed with the CRISPR Design Tool (http://crispr.mit.edu/). sgRNAs CACAGATGCACAAGACTACG and TACACGCCCTGCCCCTCTCG were used for Pkd2 exon 2 editing, and sgRNAs TACCTTCCAGAAGTCCTCCA and GTCTCTGTGAATTACTGACT were used for Pkd2 exon 3 editing. Two pairs of 20-nt (nucleotide) sgRNAs in a tail-to-tail orientation for Pkd2 knockout were cloned into the plasmid pGL3-U6-sgRNA-PGK-Hygromycin, which was obtained from the modified pGL3-U6-sgRNA-PGK-puromycin plasmid (Addgene plasmid no. 51133). sgRNA sequences were inserted between the promoters (U6 and/or H1) and the sgRNA scaffold.

The Cas9 D10A plasmid [CMV-hspCas9(D10A)-T2A-Puro; catalog no. CASLV100PA-1, System Biosciences, Inc.], pMDLg/pRRE, pRSV-Rev, and pMD2.G were transfected into the human embryonic kidney (HEK) 293 T cell line with Lipofectamine 2000 (Invitrogen) to generate Cas9 D10A LV. Cas9 D10A LV was infected into mIMCD3 cell lines, and the infected cells were selected with puromycin to obtain the stable Cas9 D10A mIMCD3 cell lines. pGL3-U6-sgRNA-PGK-Hygromycin with Pkd2-specific sgRNAs was transfected, and sgRNAs were introduced into Cas9 D10A mIMCD3 stable cells. Individual cells were transferred into 96-well plates after selection with hygromycin and puromycin. The cells were reseeded and cultured in the plates in duplicate after expansion for 2 to 3 weeks with antibiotics.

These cells were collected and digested overnight with lysis buffer. Polymerase chain reaction (PCR) products were amplified from the extracted and purified genomic DNA of the different clones. Final Pkd2 knockout mIMCD3 cell lines carrying frameshift insertions-deletions (indels) in exon 2 and exon 3 sequences of Pkd2 genomic DNA were determined by sequencing of the PCR products. Pkd2 knockout mIMCD3 cell lines were further confirmed with Western blot using an antibody toward the PC2 antibody [YCC2, as previously described (21)]. Confirmed Pkd2 knockout and Cas9 mutant control cells were maintained in DMEM/F-12 50:50 supplemented with 10% FBS and kept at 37°C in 5% CO2.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.