HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies), supplemented with 10% (v/v) fetal bovine serum (FBS; HyClone), 50 μM 2-mercaptoethanol, antibiotics [penicillin G (100 IU/ml) and streptomycin sulfate (100 IU/ml)], and 1 mM pyruvate. RAW264.7 cells were cultured in RPMI 1640 (Life Technologies), supplemented with 10% (v/v) FBS (Hyclone), 50 μM 2-mercaptoethanol, and antibiotics [penicillin G (100 IU/ml) and streptomycin sulfate (100 IU/ml)], as described (30, 71). BMMs were generated by cultivating unfractionated BM cells {obtained from female C57BL/6 mice or ERα-deficient mice [Esr1tm1Ksk (72); The Jackson Laboratories] and corresponding wild-type control mice, as indicated in figure legends} for 6 days in DMEM (Invitrogen), supplemented with 10% (v/v) FBS (Hyclone), 50 mM 2-mercaptoethanol, antibiotics [penicillin G (100 IU/ml) and streptomycin sulfate (100 IU/ml); Invitrogen], and 30% L cell–conditioned medium, as described (73).

For testing of compounds, RAW264.7 cells were seeded in complete RPMI 1640 (without phenol red) medium in 96-well plates at a cell density of 50,000 per well at least 12 hours before stimulation. Cells were treated with compounds in dose-response settings (50 to 0.023 μM in threefold dilutions) or DMSO for 30 min, followed by stimulation with various physiological TLR agonists at predetermined, roughly equieffective concentrations [CpG DNA (1 μM), R848 (300 nM), Pam3Cys (100 ng/ml), LPS (10 ng/ml)] or Curdlan (100 μg/ml). TNFα concentrations were determined in cell culture supernatants 6 hours after stimulation by ELISA, and cell viability was analyzed by the Alamar blue assay system (Invitrogen).

Replication-deficient lentivirus and MSCV were generated on the basis of Lipofectamine 2000 (Invitrogen)–based transient transfection of HEK293T cells using a four-plasmid system that was generously provided by I. Verma (for lentivirus), or an ecotropic, MSCV-based two-plasmid system. Cas9-mediated deletion of MyD88 was performed by lentiviral delivery of MyD88-specific sgRNA (genomic target sequence: GTTCTTGAACGTGCGGACAC) that was expressed by the lentiviral vector LentiCRISPR v2 provided through Addgene (74). Transduced cells were selected with puromycin (10 μg/ml) and used as polyclonal cell population.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.