CpG-DNA refers to the phosphothioate backbone containing oligonucleotide 1668 (TCCATGACGTTCCTGATGCT; TIB Molbiol). Other agonists used were LPS (E. coli 0127:B8; Sigma-Aldrich), coumermycin A1 (Sigma-Aldrich), R848 (GLSynthesis), tripalmitoyl cysteinyl lipopeptide (Pam3Cys; EMC Microcollections), and Curdlan (InvivoGen). The following antibodies were used: FLAG [M2 (soluble and bead immobilized)], β-ACTIN (Sigma-Aldrich), MyD88, IκBα, P-p38, P-JNK, P-ERK, p38, and Myc-Tag (Cell Signaling Technology), and HA (Roche); secondary antibodies were conjugated to horseradish peroxidase (GE Healthcare Life Sciences). Chemiluminescent substrate was from Thermo Fisher Scientific. ELISA kits were from eBiosciences (TNFα). Luciferase assay system was from Promega. Alamar blue assay system and Lipofectamine 2000 were from Invitrogen. Full-length human ERα and ERβ were obtained from PanVera/Invitrogen; tritiated estradiol was obtained from PerkinElmer.

Expression plasmids were established by conventional molecular biology techniques and verified by DNA sequencing. Epitope tags used consisted in tandem triple tags (HA and FLAG) or single tag (Myc), which were fused N-terminal to the complementary DNA of full-length mouse MyD88, the MyD88 DD (amino acids 2 to 109), or the MyD88 TIR domain (amino acids 157 to 296). FLAG-tagged TIRAP-GyrB was expressed as fusion protein consisting in triple FLAG-tagged, full-length mouse TIRAP, and a C-terminal GyrB moiety using a lentiviral vector containing a PGK1 promoter. FLAG-tagged MyD88-GyrB was expressed as fusion protein consisting in triple FLAG-tagged, full-length MyD88, and a C-terminal GyrB moiety using a murine stem cell virus (MSCV)–based retroviral vector (MSCV-puro; Clontech). FLAG-tagged TRAF6-GyrB was expressed as fusion protein consisting in a triple FLAG-tagged, N-terminal part of human TRAF6 (amino acids 2 to 351), and a C-terminal GyrB moiety using a pcDNA3-based vector with EF1α (elongation factor 1α) promoter.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.