Mob1a/b homozygous double-mutant mice (Rosa26-CreERT; Mob1aflox/flox; Mob1b−/−) were generated by mating Rosa26-CreERT Tg mice with Mob1aflox/flox; Mob1b−/− mice. Rosa26-CreERT Tg mice were in a C57BL/6 background, and Mob1aflox/flox; Mob1b−/− mice were backcrossed to C57BL/6 for more than six generations. To delete the floxed Mob1a gene, TAM (Sigma-Aldrich) diluted in 100% ethanol (10 mg/ml) was applied daily directly to the mouse tongue for 5 days by brush. The area of application is indicated in fig. S1A. Before TAM application, mice were anesthetized with a mixture of medetomidine hydrochloride, midazolam, and butorphanol. Mob1aflox/flox; Mob1b−/− mice treated with TAM were used as controls unless otherwise stated. Rosa26-CreERT; Mob1aflox/flox; Mob1b−/−; Yap1flox/flox and Rosa26-CreERT; Mob1aflox/flox; Mob1b−/−; Tazflox/flox mice were generated by mating Rosa26-CreERT; Mob1aflox/flox; Mob1b−/− mice with Yap1flox/flox or Tazflox/flox mice, respectively.

The primers used for mouse genotyping polymerase chain reaction were as follows: Mob1awt/flox, GTCTCGTGAAGGGTCTTGAGG/CCTGGTTGGGGTGGAGAATCAA [wt, 319 base pairs (bp); flox, 450 bp]; Mob1aΔ, GTAATGTGTTCAGCTATGCTTTGAC/CCTGGTTGGGGTGGAGAATCAA (551 bp); Mob1bwt, CTTCAGGATCCTTGGTGGTTATCAG/AGAGCAAGGGGAAAAGAAGCTCAATG (586 bp); Mob1bmutant, CTTCAGGATCCTTGGTGGTTATCAG/TCAGGGTCACAAGGTTCATATGGTG (673 bp); Rosa26-CreERT Tg, AAAGTCGCTCTGAGTTGTTAT/CCTGATCCTGGCAATTTCG (825 bp); Yap1wt/flox, GCCCAAACATACCCACGTAAT/CAGTCCAGTCAAGACAAGAT (wt, 192 bp; flox, 336 bp); Tazwt/flox, AAGCAGTTTCCACTTCATGAAAC/AGTCAAGAGGGGCAAAGTTGTGA (wt, 250 bp; flox, 330 bp).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.