RNA was isolated from HL60 cells using an RNeasy mini kit with deoxyribonuclease treatment (Qiagen, no. 74704) according to the manufacturer’s recommended procedures, and yields and purity were assessed using a NanoDrop2000 Spectrophotometer (Thermo Fisher Scientific). Complementary DNA synthesis was accomplished with 1 μg of total RNA using iScript (Bio-Rad #170-8891) according to the manufacturer’s procedures. CD44 gene expression was analyzed with CD44 primers purchased from OriGene (no. HP200577), and data were normalized to glyceraldehyde-3-phosphate dehydrogenase using forward (CATGAGAAGTATGACAACAGCCT) and reverse (AGTCCTTCCACGATACCAAAGT) primers purchased from Life Technologies.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.