Cells were grown on gels for 24 hours before harvesting with TRIzol (Invitrogen) for total RNA extraction. Power SYBR RNA-to-CT 1-Step Kit (4391178, Thermo Fisher Scientific) was used for reactions. The quantitative polymerase chain reaction (PCR) reactions were run with the ViiA 7 Real-Time PCR System and analyzed with QuantStudio Real-Time PCR Software. CTGF and ANKRD1 gene expression were calculated with the comparative Ct method relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers used were ANKRD1 forward primer, AGTAGAGGAACTGGTCACTGG; ANKRD1 reverse primer, TGGGCTAGAAGTGTCTTCAGAT; CTGF forward primer, AGGAGTGGGTGTGTGACGA; CTGF reverse primer, CCAGGCAGTTGGCTCTAATC; GAPDH forward primer, CTGGGCTACACTGAGCACC; GAPDH reverse primer, AAGTGGTCGTTGAGGGCAATG.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.