The first exon of the ifnphi3 gene was edited using CRISPR technology. A guide RNA targeting the sequence TGGACCTTCACCGTGTGGCC(TGG) and recombinant CAS9 protein (both from TACGene, France) were coinjected in one-cell stage eggs of wt AB zebrafish. F0 animals were raised to adulthood and backcrossed to AB. One F0 founder was found to transmit a mutated allele of ifnphi3 in which the sequence tcaga(ATG)GACCTTCACCGTGTGG, encompassing the predicted start codon of ifnphi3 (in parenthesis), was replaced with ATT. This results in the loss of the first 31 amino acids of the predicted protein, including its leader peptide and the first cysteine involved in a disulfide bridge key for the cytokine structure (56). One F1 fish bearing this allele, designated ifnphi3ip7, was backcrossed to AB, and heterozygous F2 males and females were incrossed to generate homozygous ifnphi3ip7/ip7 F3 fish. These developed normally and grew in viable and fertile adults. F4 ifnphi3ip7/ip7 mutants were used to produce the eggs used in that study.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.