Eggs of wild-type AB zebrafish (one-cell stage) were microinjected with 4 ng of the KARS- specific antisense morpholino (MO3i3, TCCATATTCGCTACTCATCGTACA) or with a control morpholino (MOctl, GAAAGCATGGCATCTGGATCATCGA). The KARS-specific MO targets the splice donor site between exon 3 and intron 4. Efficiency of knockdown was assessed by RT-qPCR with splice-sensitive primers [TGGACCCCAATCAATACTTCAAG (forward) and GGTCTCCAGGCTGAAGGTGGTTAT (reverse)]. Embryos then developed with no obvious morphological defects at 28°C. At 72 hours after injection, embryos were collected for gene expression analysis by RT-qPCR.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.