Total RNA was extracted from NB4 cells with TRIzol (Invitrogen) and then purified using the RNeasy kit (Qiagen). Reverse transcription was performed with the SuperScript II Kit (Invitrogen), according to the manufacturer’s protocol. qPCRs were performed in triplicates in 20 μl of final reaction volume containing SYBR Green buffer (Applied Biosystems), 20 ng of cDNA retrotranscribed from the RNA, and 0.4 μM of each primer mix. All the qPCR amplifications were performed in the AB-7000 sequence detection system (Applied Biosystems) at 50°C for 2 min and 95°C for 10 min, followed by 40 cycles at 95°C. For reverse transcription qPCRs, the following primers were used: glyceraldehyde phosphate dehydrogenase (GAPDH) forward, GCCTCAAGATCATCAGCAATGC; GAPDH reverse, CCACGATACCAAAGTTGTCATGG; CD11b forward, AACCCCTGGTTCACCTCCT; CD11b reverse, CATGACATAAGGTCAAGGCTGT; GFI1b forward, CAGGGAGGGGAACAGAAGAG; and GFI1b reverse, GAACTGCAAAGCCTCTCTCG.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.