For the validation of specific regions, ChIP-qPCRs were performed as follows. Immunoprecipitated DNA was diluted in 9.6 μl of H2O per reaction, plus 400 nM primers in a final volume of 20 μl in SYBR Green. Each ChIP experiment was performed at least three times with biological replicates. For ChIP-qPCRs, the following primers were used: negative control forward, AGCTATCTGTCGAGCAGCCAAG; negative control reverse, CATTCCCCTCTGTTAGTGGAAGG; PRAM1 forward, CCACAGAGCCTCCCCTAGA; PRAM1 reverse, TGCAACACCTCCCTGTGA; peptidase inhibitor 16 (PI16) forward, AGCCCTCACAGATGAGGAGA; PI16 reverse: GCCACACTTACCATGTGCAG; Integrin subunit alpha (ITGAM) forward, GGAGGAGAAGTGACATGGCT; ITGAM reverse, AGGCAAAGTGGAGATGGTGA; transgutaminase 2 (TGM2) forward, CAGATACAGACACACGCAGC; TGM2 reverse, TGGGGAGGTGTTCTTGATCC; CD86 forward, ACAGTCATTGCCGAGGAAGG; CD86 reverse, CTCATCCGTGTGTCTGTGCT; GFI1b forward, CAGGGAGGGGAACAGAAGAG; and GFI1b reverse, GAACTGCAAAGCCTCTCTCG.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.