The lentiviral CRISPRv2 vector was cotransfected with vesicular stomatitis virus glycoprotein and dR8.2 plasmids into 293T cells, and the viral supernatants were produced as previously described (33). Cells were spin-infected with viral supernatant and selected with puromycin-containing medium for 3 days. After clonal growth by limiting dilution, sublines were screened by Western blotting against LSD1.

To knock down LSD1, two short hairpin RNA (shRNA) sequences were tested. Interfering sequences were cloned into the LMP vector by Xho–Eco RI double digestion. shRNA transcription in these vectors is RNA polymerase II mediated and is under the control of an long terminal repeat promoter and expresses puromycin resistance cassette (shLSD1#3, TGCTGTTGACAGTGAGCGAAGTGATACTGTGCTTGTCCACTAGTGAAGCCACAGATGTAGTG GACAAGCACAGTATCACTGTGCCTACTGCCTCGGA and shLSD1#5, TGCTGTTGACAGTGAGCGATCTCAGAAGATGAGTATTATTTAGTGAAGCCACAGATGTAAAT AATACTCATCTTCTGAGAGTGCCTACTGCCTCGGA).

LSD1 N-terminal truncated (172-833) wild-type and catalytic mutant (K661A-LSD1) constructs were a gift by E. Battaglioli (University of Milan). Constructs were PCR-amplified from original vectors and cloned into pCR 2.1-TOPO (Invitrogen) using the following primers: LSD1 forward, ATGTCGGGTGTGGAGGGCGCAGCTTTC and LSD1 reverse, TCACATGCTTGGGGACTGCTGTGC.

Products were then subcloned into the Eco RI site of the retroviral PINCO vector for ectopic expression. To make the D553,555,556A triple mutant construct described in (24), the following primers were used in three sequential site-directed mutagenesis reactions using the pCR-TOPO-LSD1WT as the template vector: LSD1_D553A forward, CTTAAGCACTGGGCTCAGGATGATGACTTTGAGTTC; LSD1_D553A reverse, GAACTCAAAGTCATCATCCTGAGCCCAGTGCTTAAG; LSD1_D553,555A forward, CTTAAGCACTGGGCTCAGGCTGATGACTTTGAGTTC; LSD1_D553,555A reverse, GAACTCAAAGTCATCAGCCTGAGCCCAGTGCTTAAG; LSD1_D553,555,556A forward, CTTAAGCACTGGGCTCAGGCTGCTGACTTTGAGTTC; and LSD1_D553,555,556A reverse, GAACTCAAAGTCAGCAGCCTGAGCCCAGTGCTTAAG.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.