The CRISPR-Cas9 gene editing vector lentiCRISPR v2 was a gift from F. Zhang (Addgene, plasmid no. 52961). The CRISPR target sequence CGCGGAGGCTCTTTCTTGCG in exon 1 was selected to knock out LSD1 and cloned into lentiCRISPR v2 vector following the manufacturer’s instructions.

Note: The content above has been extracted from a research article, so it may not display correctly.

Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.

We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.