PAGFP-N1-CerS1 was generated by subcloning human CerS1 sequence from pcDNA3.1-FLAG-HA-CerS1 using Infusion HD Cloning Kit (Clontech) according to the manufacturer’s instructions. pMD2.G and psPAX2 were a gift from D. Trono (Addgene plasmids #12259 and #12260). pCMV6-AC-CalR-mRFP-ER was obtained from OriGene (RC100108). SV40 1: pBSSVD2005 was a gift from D. Ron (Addgene plasmid #21826). pSelect-LC3-GFP was a gift from A. Cowart (Virginia Commonwealth University, Richmond, VA). pEGFP-Drp1WT, pEGFP-Drp1K38A(DN), and pEGFP-Drp1C644A were a gift from S. A. Lipton (Burnham Institute for Medical Research, La Jolla). pEGFP-Drp1C644W was generated from pEGFP-Drp1WT using Q5 site-directed mutagenesis kit (New England Biolabs) according to the manufacturer’s instructions. Primer sequences used for generation of C644W Drp1 mutants were as follows: forward, 5′-CGGGAACAGCGATGGGAGGTTATTGAACGA-3′; reverse, 5′-TCGTTCAATAACATCCCAATCTCGCTGTTCCCG-3′. The pIRES2CerS1Δ60–76 was generated from pIRES2CerS1WT using site-directed mutagenesis and the following primers: forward, 5′-CTC GGGCGGCGCCAGGTGCGC-3′; reverse, 5′-GCGGCCACTGCGGCGCCTCTTTC-3′. pcDNA3.1-FLAG-CerS6ΔHox/CS1(60–76) was generated from pcDNA3.1-FLAG-CerS6WT using site-directed mutagenesis in two steps: (i) To delete the Hox domain, the following primers were used: forward, 5′-CCGCCCAATGCCATTTCCAAGCAACTGGAC-3′; reverse, 5′-GTCCAGTTACTTGGCAATGGCATTGGGCGG-3′. (ii) To insert CS1 (60 to 76), the following megaprimers were used: forward, 5′-CAGGCCAATGGACCACAAATTGCTCCGCCCAATGCCATTCTGCTGCTGCTGGCGCTCGGCGCGCTGGGCTGGACCGCCCTGCGCTCCTCCAAGCAACTGGACTGGGATGTTCGAAGCATTCAGCGC-3′; reverse, 5′-GCGCTGAATGCTTCGAACATCCCAGTCCAGTTGCTTGGAGGAGCGCAGGGCGGTCCAGCCCAGCGCGCCGAGCGCCAGCAGCAGCAGAATGGCATTGGGCGGAGCAATTTGTGGTCCATTGGCCTG-3′; p17 cDNA was amplified from total cDNA by PCR using the following primers: forward, 5′-ATG GCCAAGTCCAAGAACCAGAGCACAA-3′; reverse, 5′-CTACTCTGAAGCCTTTGTAGGGGCCTGG-3′. The resulting cDNA was inserted in vector PCR 2.1 using the TA-cloning kit (Thermo Life Technologies) and subcloned into FLAG-HA-pcDNA3.1 (a gift from A. Antebi, Addgene plasmid #52535) using the following primers: forward, 5′-CTGGCGGCTCGAATGGCCAAGTCCA-3′; reverse, 5′-TAGATGCATGCTCGACTACTCTGACTCTGAAGCCT-3′ and the Infusion HD Cloning Kit (Clontech), according to the manufacturer’s instructions. p17R68A, p17R107A, p17R111A, p17RYE28-30AAA, p17RKW14-16AAA, p17LKKPR21-25AAA, and p17Δ20 constructs were generated from FLAG-HA-pcDNA3.1-p17WT using the following primers: p17R68A: forward, 5′-CAGTCCCGAAAAGCCCAAAGAAATGG-3′; reverse, 5′-CCATTTCTTTGGGCTTTTCGGGACTG-3′; p17R107A: forward, 5′-CGTGAGTGCAGCTGCTGAGGCTATC-3′; reverse, 5′-GATAGCCTCACGTGCACTCACG-3′; p17R111A: forward, 5′-CAAGCTTGGGAAGGCTGCTCATGCC-3′; reverse, 5′-GGCATGAGCAGCCTTCCCAAGCTTG-3′; p17RYE28-30AAA: forward, 5′-CGTGCTCATGCCGCCATTGTCAAGG-3′; reverse, 5′-CCTTGACAATGGCGGCATGAGCAGG-3′; p17RKW14-16AAA: forward, 5′-CAGCACAAACAACCAGTCCGCAGCAGCGCAAAGAAATGGTCTC-3′; reverse, 5′-GAGACCATTTCTTTGCGCTGCTGCGGACTGGTTGTTTGTGCTG-3′; p17LKKPR21-25AAA: forward, 5′-GAAAATGGCAAAGAAATGGTGCGGCGGCGGCCTCACAAAGATACG-3′; reverse, 5′-CGTATCTTTGTGAGGCCGCCGCCGCACCATTTCTTTGCCATTTTC-3′; p17Δ20: forward, 5′-CACACTGGCGGCCGCTCGAATGCAATCCCTTAAGGGGGTGG-3′; reverse, 5′-CCACCCCCTTAAGGGATTGCATTCGAGCGGCCGCCAGTGTG-3′.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.