This study was approved by the Institutional Review Board, and written informed consent was obtained from the patients. A BAP1 wild-type uveal melanoma cell line (UMM055) and a BAP1-mutant uveal melanoma cell line (UMM061) were generated from patient-derived xenografts (PDXs) generated from patients undergoing enucleation. PDXs were expanded in the intrascapular fat pad of NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ JAX immunodeficient (NSG) mice for up to 3 months. The tissue was digested with collagenase IV for 3 hours at 37°C, dissected into a single-cell suspension by pipetting, and cultured in 5% partial pressure of oxygen (pO2) in the UMM media containing Dulbecco’s modified essential medium (DMEM)/F12 with 5% heat-inactivated fetal bovine serum (HI-FBS), B-27 minus vitamin A (Life Technologies), 1% penicillin-streptomycin, 2 mM Glutamax, basic fibroblast growth factor (bFGF) (10 ng/ml) (PeproTech), recombinant stem cell factor (rSCF) (10 ng/ml) (PeproTech), and epidermal growth factor (20 ng/ml) (PeproTech). Cell culture surface was coated with 0.1% porcine gelatin (Millipore Sigma) before plating. PDX-derived BAP1-mutant UM cell line MP38 and BAP1 wild-type UM cell line MP41 were provided by S. Roman-Roman (40) and maintained in 5% pO2 in DMEM/F12 with 10% HI-FBS, 1% penicillin-streptomycin, 2 mM Glutamax, and 0.5% insulin-transferrin-selenium (Thermo Fisher Scientific). A cell line was generated from a normal UMC sample derived from unaffected normal intraocular uveal tissue in a patient undergoing enucleation. The uveal tissue was digested with collagenase IV for 3 hours at 37°C, dissected into a single-cell suspension by pipetting, and cultured in 5% pO2 in the UMC media containing Ham’s F12 with 10% HI-FBS, 1% penicillin-streptomycin, 2 mM Glutamax, 100 μM 3-isobutyl-1-methylxanthine, and 10 ng/ml of each: bFGF (PeproTech), rSCF (PeproTech), and cholera toxin (Sigma-Aldrich). UMCs were enriched relative to other cell types by addition of G418 (100 μg/ml) (Thermo Fisher Scientific) to the media for the first 5 days in culture. UMCs were then immortalized by retroviral expression of human TERT (Addgene plasmid no. 1773), followed by hygromycin selection. UMCs with knockout of BAP1 were created by clonally isolating UMCs stably transduced with lentiviral particles encoding spCAS9 (Addgene plasmid no. 50661) and guide RNA against BAP1 (Addgene plasmid no. 64114) directing the CRISPR-mediated deletion of the first exon of the BAP1 gene. Immunofluorescence microscopy was performed on UM and UMC cells using Santa Cruz Biotechnology antibodies against HDAC4 (sc-46672) and BAP1 (sc-28236). shRNA CGACAGGCCTCGTGTATGATT and AAATTACGGTCCAGGCTAATT sequences targeting human HDAC4 cDNA (shHDAC4) were individually cloned into a pLH-spsgRNA2 vector (Addgene plasmid no. 64114) and stably integrated into UM cells via lentiviral transduction and selection with hygromycin B (50 μg/ml). Nonspecific shRNA sequence AACAGCCACAACGTCTATATC (shSCR) was used as control. Equal amount of shSCR- or shHDAC4-expressing cells was plated into 12-well plate, and after 2 weeks, the cells were stained using 0.5% crystal violet and 6% glutaraldehyde solution and counted using ImageJ.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.