RNA isolation, reverse transcription, and real-time polymerase chain reaction

Total RNA was extracted with TRIzol (Thermo Fisher Scientific), phase-separated with chloroform, and precipitated using isopropanol. One microgram of RNA was reverse-transcribed using iScript cDNA Synthesis Kit (Bio-Rad), according to the manufacturer’s instructions. iTaq Universal SYBR green reagent (Bio-Rad) was used to detect gene expression during amplification of complementary DNA after initial denaturation at 95°C for 30 s for one cycle and 95°C for 5 s and 60°C for 30 s for 40 cycles on a polymerase chain reaction (PCR) cycler (Bio-Rad). The mouse primer sequences are as follows:

OSX (forward, TGCCTGACTCCTTGGGACC; reverse, TAGTGAGCTTCTTCCTCAAGCA), OPN (forward, AAACCAGCCAAGGTAAGCCT; reverse, TCAGTCACTTTCACCGGGAG), NFATC1 (forward, GGTAACTCTGTCTTTCTAACCTTA; reverse, GTGATGACCCCAGCATGCACCAGTCACAG), CTSK (forward, GGGCTCAAGGTTCTGCTGC; reverse, TGGGTGTCCAGCATTTCCTC), ACP5 (forward, CAGCAGCCCAAAATGCCT; reverse, TTTTGAGCCAGGACAGCTGA), ESR1 (forward, CTTGAACCAGCAGGGTGGC; reverse, GAGGCTTTGGTGTGAAGGGT), ESR2 (forward, GACGAAGAGTGCTGTCCCAA; reverse, GCCAAGGGGTACATACTGGAG), ADORA2B (forward, ATCTTTAGCCTCTTGGCGGTG; reverse, GACCCAGAGGACAGCAATGAT), and 18S ribosomal RNA (forward, ACCAGAGCGAAAGCATTTGCCA; reverse, ATCGCCAGTCGGCATCGTTTAT).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.