Construction of strains with constitutively expressed FlhDC

A series of strains were constructed where the native class I promoter, flhDp, was replaced with a synthetic constitutive promoter of different transcriptional strength (the “Pro” promoters) (31). The native RBS for FlhD was also replaced with either the T7 RBS or a mutant RBS (“mut4”) with the sequence TTTAAGAATTGCATATACAT (mutated bases in bold). To construct these strains, plasmids consisting of a synthetic Pro promoter, a T7 or mut4 RBS, and FlhDC coding sequence were constructed. Subsequently, a linear fragment consisting of the Pro promoter, T7 or mut4 RBS, and FlhD, with overhangs homologous to the 5′-end of the flhDp was amplified from the plasmid template. This linear fragment was chromosomally inserted via red recombination. See the “Construction of strains with constitutively expressed FlhDC” section in the Supplementary Materials for more details.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.