Construction of transcriptional reporter strains

Construction of cloning vectors. Cloning vectors pMK4 and pMK7 were constructed from pUA66 (55). pMK4 consists of a cloning site with two Bsa I sites: the RBS of gene 10 in T7 phage (“T7 RBS”) with the sequence TTTAAGAAGGAGATATACAT and Venus NB (“VenNB”) (5). pMK7 consists of two Bsa I sites, a T7 RBS and SCFP3A (25), and the selective marker is replaced with ampicillin resistance. These vectors were assembled from linear fragments via isothermal assembly using the NEB HiFi DNA Assembly Master Mix (New England Biolabs) following manufacturer protocols. See the “Construction of cloning vectors for transcriptional reporters” section in the Supplementary Materials for details.

Construction of transcriptional reporter cassettes. A region of the MG1655 chromosome encompassing the flagellar promoter of interest and >30 bp of the protein coding sequences flanking the promoter was amplified by polymerase chain reaction (PCR) to account for potentially unknown regulator binding sites. The PCR primers were designed to contain overhangs that contained Bsa I sites with compatible target sequences to pMK4 or pMK7. The PCR product was inserted into pMK4 or pMK7 via Golden Gate assembly using the previously described high-efficiency protocol of cycling between 3-min incubation at 37°C and 4-min incubation at 16°C for 25 cycles (56).

Chromosomal insertion of transcriptional reporters. The transcriptional reporters were inserted into one of two chromosomal loci: the lambda attB site or GalK. Both loci have previously been used for the insertion of chromosomal transcriptional reporters (5759). The two sites are approximately 20 kb apart, which is not only sufficiently far to prevent read-through transcription (which is already low due to the strong rrnB T1 terminator at the end of each reporter cassette) but also sufficiently close to each other so that variations in copy number during replication can safely be ignored. To integrate transcriptional reporters into these sites, the reporter cassette was PCR-amplified from the plasmid template with primers containing at least 40-bp overhang homologous to the target locus. This PCR fragment was inserted chromosomally using the red recombination technique described above.

Construction of the class I transcriptional reporter. To monitor class I transcription, a cassette composed of the T7 RBS and VenNB was directly integrated into the 3′UTR of the endogenous FlhDC transcript using the scarless technique described above. See the “Construction of the class I transcriptional reporter” section in the Supplementary Materials for details.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.