Quantitative reverse transcription polymerase chain reaction was performed as previously described (40). Primer sequences used for the reactions are listed as follows: Zic5, TCAAGATCCACAAGCGTACTC (forward) and AGCCTCGAATCTTGCAGTAG (reverse); SLC2A1/GLUT1, GGACAGGCTCAAAGAGGTTATG (forward) and AGGAGGTGGGTGGAGTTAAT (reverse).

Note: The content above has been extracted from a research article, so it may not display correctly.

Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.

We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.