Guide RNA for each target genes was designed with CRISPRdirect (47) (https://crispr.dbcls.jp/). Target specific CRISPR RNA (crRNA), ATTO550-conjugated trans-activating crRNA (tracrRNA), Cas9 protein were purchased from Integrated DNA Technologies Inc. (IL, USA). Target-specific sequence of crRNA for Alpl (NM_007431) without proto-spacer adjacent motif sequence is CTTGCTGTCGCCAGTAACTG (318-340). Ribonucleoprotein (RNP) complex was formed according to the manufacturer’s protocol, and RNPs were transfected to 1 × 105 KUSA-A1 cells using the Neon electroporation system (Thermo Fisher Scientific, MA, USA) with 10-μl tips. Nuclear localization of ATTO550 particles were confirmed on the next day of transfection under a fluorescent microscope (Nikon, Japan).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.