Cells were co-transfected with a pair of guide RNAs and pX330-U6-Chimeric_BB-CBh-hSpCas9 (38) and another vector with puromycin resistance using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA) and selected with puromycin (Thermo Fisher Scientific) at 2 μg/ml for 3 days. Cells were seeded in 96-well plates and selected for single clones after 2 to 3 weeks. Genomic DNA was isolated using genomic lysis buffer [10 mM tris-HCl (pH 7.5), 10 mM EDTA, 10 mM NaCl, and 0.5% sarcosyl] at 60°C for 2 hours and precipitation buffer (150 mM NaCl in 100% EtOH) at room temperature for 30 min. Polymerase chain reaction screening was performed using the primers as follows and further confirmed by Western blot and RNA-seq: Zic5 WT, TGAATCACGTCACGGTGGAG (forward) and GGCCTGTGTGTGCTATCGAA (reverse); Zic5 KO, CGTCTACTGTCTATGCGCCC (forward) and TGAAGAGTGTGTCACGGTGG (reverse); Zic2 WT, CCACCAACAACGCTTGTGAA (forward) and TGAGGCGTACCCAGGTCAAT (reverse); and Zic2 KO, CCCAGCAGCCTGTGTGATTT (forward) and GAGACCTTCTGCCAAACGGG (reverse). pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from F. Zhang (Addgene plasmid no. 42230).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.