Quantitative polymerase chain reaction (PCR) was performed using the SYBR Green System according to the manufacturer’s protocol (Applied Biosystems, Foster City, CA). The expressions of target genes were analyzed using the ΔCt method. The primers for miR-466l (MQP-0101) and 5S ribosomal RNA (rRNA) (MQP-0301) were obtained from Guangzhou RiboBio Co. Ltd. (Guangdong, China). The forward and reverse primers for other genes are as follows:

mFGL2-F GGTGCTCAAAGAAGTGCGGA and mFGL2-R GTTCCTGGACTCTACTGTCCTC; m5-LOX-F CCTATTCCTCCCTGTGTTTCC and m5-LOX-R CACGAGCAGTCCATCATCAC; m12/15-LOX-F GGCTCCAACAACGAGGTCTAC and m12/15-LOX-R CCCAAGGTATTCTGACACATCC; mCOX-2F GGTGCCTGGTCTGATGATGT and mCOX-2-R TGCTGGTTTGGAATAGTTGCT; mLTA4H-F GAGGTCGCGGATACTTGCTC and mLTA4H-R CTCCTGTGACTGGACCGTG; mPGDH-F GGACACACCCATCCTTGAAT and mPGDH-R TCGATGCCGTGATCTTCATA; mβ-ACTIN-F TGACAGGATGCAGAAGGAGA and mβ-ACTIN-R GTACTTGCGCTCAGGAGGAG; hADAM10-F CAACCTACGAATGAAGAGGGACAC and hADAM10-R CCACCACGAGTCTGGATGAATC; hADAM17-F GAAGTGCCAGGAGGCGATTA and hADAM17-R CGGGCACTCACTGCTATTACC; and hβ-ACTIN-F GCGCGGCTACAGCTTCA and hβ-ACTIN-R CTTAATGTCACGCACGATTTCC.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.