The plasmids pET-28b-Soc, pET-28b-Soc-β-gal, and pET-28b-F1mutV-Soc were constructed as previously described (10, 12). For the construction of pET-28b-BAP-Hoc, two rounds of polymerase chain reaction (PCR) were performed to amplify BAP-Hoc using three primers: FW1, ATCGAGTGGCACGAGGGTCTTTCGATGACTTTTACAGTTGATATAACTCC; FW2, TTCTAGCTAGCGGTCTTAACGACATCTTCGAGGCACAGAAGATCGAGTGGCACGAGGGTCTTTCG; and RW, ATAAAGCTTTTATGGATAGGTATAGATGATACCAGTTTC. The first round of PCR was performed by fusing Hoc to part of the BAP sequence using the FW1 and RW primers. Full-length BAP-Hoc was obtained by the second round of PCR using the FW2 and RW primers and then digested with Nhe I and Hind III. The digested BAP-Hoc fragment was subcloned into the pET-28b vector. The BirA-expressing plasmid pET-21a-BirA was purchased from Addgene (plasmid no. 20857). Plasmids pAAV-DJ, pAAV-Helper, pAAV-GFP, pAAV-luciferase, and pAAV-mCherry were purchased from Cell Biolabs. To clone DJ-H75A-D76N mutant, upstream fragment was amplified using the primers AN-F (CGCGGAAGCTTCGATCAACTACGCAGACAG) and HD-AN-R (GTTTGCCTCGAGGGCCGCGGCGTCTGCCTC) and the template pAAV-DJ, and downstream fragment was amplified using the primers HD-AN-F (CCGCGGCCCTCGAGGCAAACAAAGCCTACGACCGGCAGCTCGACA) and AN-R (GAGAACGTACGGCAGCTGGTACTCCGAGTC). Then, the two fragments were mixed in equal amounts and used as a template to amplify DJ-H75A-D76N using the primers AN-F and AN-R. The PCR products were subsequently cloned into the pAAV-DJ vector at the Hind III/Bsi WI restriction sites to construct pAAV-DJ-H75A-D76N. Influenza HA4900 DNA fragment was synthesized by Invitrogen according to a recent report (31) and then subcloned into the pAAV vector after digestion with Eco RI and Hind III. All the constructed plasmids were sequenced to confirm correct fragment insertion (Retrogen, CA).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.