Ribosomes (70S) were prepared from E. coli according to the published protocol (31). Fluorescence labeling of ribosomal subunits is described in detail (24). The extent of subunit labeling was determined spectroscopically and was close to 100%, and the activity was tested as reported (24, 32). Mutations in the ribosomal protein S12 were introduced into the chromosome-encoded rpsL (ribosomal protein uS12) gene in E. coli strain MDS57 (33). The genomic region containing the gene was PCR-amplified as two overlapping sections to simultaneously clone and introduce mutations. The R49K mutation was introduced using primer pairs MDP_AEQ and MDP_AER and MDP_AES and MDP_AER, generating strain MDP_224. The K42N mutation was introduced using primer pairs MDP_AEQ and MDP_AEX and MDP_AEW and MDP_AER, generating strain MDP_232. The plasmid pKO3 (34) was PCR-amplified with primers MP527 and MP528. Each set of three PCR products was assembled into a circular plasmid using Gibson Assembly (35), and the scarless genomic modifications were generated by two-step homologous recombination. The following primers were used:

MDP_AEQ, GCGGTATTGGTAGTCCCACAACACCGTAGGGATTTACCTTAAGCGGACTT;

MDP_AER, CGTCTATTGAATCGGAGCACCCACAGTCACCGGTGTAGAACAGAATACG;

MDP_AES, GAACTCCGCGCTGAAGAAAGTATGCCGTGTTCGTCTGACTAACGGTTTCG;

MDP_AET, CCGTTAGTCAGACGAACACGGCATACTTTCTTCAGCGCGGAGTTCGGTTT;

MDP_AEW, TGTATATACTACCACTCCTAACAAACCGAACTCCGCGCTGCGTAAAGTAT;

MDP_AEX, TTCGGTTTGTTAGGAGTGGTAGTATATACACGAGTACATACGCCACGTTT;

MP527, ACTGTGGGTGCTCCGATTCAATAGACGGATCCTCTAGAGTCGACCGGAGA;

MP528, TACGGTGTTGTGGGACTACCAATACCGCGGCCGCGATCCCCGGGTACCGA.

Beginning with a single colony, a 50-ml culture was grown overnight at 37°C with shaking in LB medium without antibiotics. The following day, 1 ml was transferred into each of 12 500 ml of LB medium in flasks (6 liters in total) and grown for ~24 hours at 37°C with shaking in LB medium. The following day, the cells were centrifuged for 10 min at 4000 rpm in 1-liter buckets, resuspended and combined in 500 ml of fresh LB medium at 37°C, and allowed to grow with shaking for 1 hour at 37°C. The cells were then centrifuged 10 min at 4000 rpm in a 1-liter bucket. The cells were washed once with buffer A [20 mM Tris-Cl (pH 7.5), 100 mM KCl, and 15 mM MgCl2], and the pellet was either frozen in liquid nitrogen or directly resuspended in ~100 ml of ice-cold buffer A for lysis. The cells were lysed with a single pass through an EmulsiFlex homogenizer. The lysate was then clarified by (2×) 10-min centrifugation at 13,000 rpm in Falcon tubes. The clarified lysate was then layered on top of a 30-ml cushion of buffer A containing 40% sucrose in Ti45 tubes and centrifuged 17 to 24 hours at 37,000 rpm in a Ti45 rotor. All of the pellets were briefly washed with buffer A and then resuspended in ~500 μl of buffer A (2 to 3 ml in total volume) using small stir bars at 4°C. The resuspended ribosomes were transferred to 1.5-ml tubes, heated to 37°C for 5 min, and then centrifuged at max speed at 4°C in a tabletop centrifuge for 5 min. The supernatant was transferred to fresh tubes, either frozen in liquid nitrogen or diluted to 20 mg/ml, layered on top of 10 to 40% sucrose gradients in buffer A in SW32 tubes (~10 mg ribosomes per gradient; 500 μl), and centrifuged at 22,000 rpm for 17 hours with an SW32 rotor. The gradients were fractionated from the top by hand, in 1-ml fractions, into 1.5-ml tubes. The optical density at 260 nm (OD260) for each fraction was checked and plotted to determine which fractions contained the 70S ribosomes. These fractions were combined and centrifuged in a Ti45 rotor 17 to 24 hours at 37,000 rpm. The 70S pellets were resuspended in buffer A, and the buffer was exchanged three times using a centrifugal concentrator with a 100,000 molecular weight cutoff. The concentration was adjusted to 8 μM (20 mg/ml), and 50 ml of aliquots was frozen in liquid nitrogen and stored at −80°C.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.