All experiments were carried out in HiFi buffer [50 mM tris-HCl (pH 7.5), 70 mM NH4Cl, 30 mM KCl, 3.5 mM MgCl2, 8 mM putrescine, and 0.5 mM spermidine) (3). Chemicals were from Roche Molecular Biochemicals, Sigma-Aldrich, or Merck, and nucleotide triphosphates were from Jena Bioscience. Radioactive compounds were from Hartmann Analytic. Total Escherichia coli tRNA was from Roche Molecular Biochemicals. EF-Tu, initiation factors, [3H]Met-tRNAfMet, f[3H]Met-tRNAfMet, and BODIPY-[3H]Met-tRNAfMet were prepared from E. coli as described (3). Site-directed mutagenesis of the gene 60 construct (29) was performed using the QuickChange polymerase chain reaction (PCR) protocol (3). The sequence of the SecM mRNA construct was ATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGAATATCAACACTGGTTACGTGAAGCAATAAGCCAACTTCAGGCGAGCGAAAGCCCGCGGCGTGATGCTGAAATCCTGCTGGAACATGTTACCGGCAAAGGGCGTACTTTTATCCTCGCCTTTGGTGAAACGCAGCTGACTGACGAACAATGTCAGCAACTTGATGCGCTACTGACACGTCGTCGCGATGGTGAACCCATTGCTCATTTAACCGGGGTGCGAGAATTCTGGTCGTTGCCGTTATTCAGCACGCCCGTCTGGATAAGCCAGGCGCAAGGCATCCGTGCTGGCCCTATGTCCGGTAAAATGACTGGTATCGTAAAATGGTTCAACGCTGACAAAGGCTTCGGCTTCATCACTCCT. mRNAs were produced by T7 RNA polymerase in vitro transcription and purified by ion exchange chromatography on a HiTrap Q HP 5-ml column (GE Healthcare).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.