DNA (60 ng) was amplified in a reaction volume containing the following reagents: QuantStudio 3D Digital PCR Master Mix v2 (Thermo Fisher Scientific), Custom TaqMan Copy Number Assays SM 20× FAM labeled (Thermo Fisher Scientific), and TaqMan Copy Number Reference Assay 20× (Thermo Fisher Scientific) VIC labeled (Thermo Fisher Scientific). The mix was loaded on a chip using the QuantStudio 3D Digital PCR Chip Loader. The chips were then loaded on the ProFlex PCR System (Thermo Fisher Scientific), and data were analyzed using the “QuantStudio 3D AnalysisSuite Cloud Software.” The entire process was performed by the qPCR Service at Cogentech, Milano [Custom (FLAG) TaqMan Copy Number Assays: forward primer, TGGACAGTCCAGAGGACGAA; reverse primer, CACCCTTGTCGTCATCGTCTT; and probe, FAMACAGAAGAAGGACTACAAAGACG and TaqMan Copy Number Reference Assay: TERT (VIC) (catalog number 4403316)].

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.