RNA was extracted using the RNeasy Micro Plus Kit (QIAGEN) according to the manufacturer’s instructions. Retrotranscribed cDNA was obtained from 0.5 to 1 μg of total RNA using the SuperScript VILO retrotranscription kit (Thermo Fisher Scientific).

Real-time qPCR was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems) using SYBR Green Master Mix (Applied Biosystems) as the detecting reagent. A total cDNA amount corresponding to 15 ng of starting RNA was used for each reaction. Each sample was analyzed in triplicate and normalized to GAPDH. Relative mRNA quantity was calculated by the comparative cycle threshold (Ct) method using the formula 2−∆Ct [BAZ1B, CCTCGCAGTAAGAAAGCAAAC (forward) and ACTCATCCAGCTCCTTTTGAC (reverse); GAPDH, GCACCGTCAAGGCTGAGAAC (forward) and AGGGATCTCGCTCCTGGAA (reverse); NR2F1, AGAAGCTCAAGGCGCTACAC (forward) and GGGTACTGGCTCCTCACGTA (reverse); NR2F2, GCAAGTGGAGAAGCTCAAGG (forward) and GCTTTCCACATGGGCTACAT (reverse); TFAP2A, GCCTCTCGCTCCTCAGCTCC (forward) and CGTTGGCAGCTTTACGTCTCCC (reverse); and SOX9, AGTACCCGCACTTGCACAAC (forward) and GTAATCCGGGTGGTCCTTCT (reverse)].

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.