RNA was extracted using an RNA extraction kit (Zymo), and complementary DNA (cDNA) was made using 0.75 μg of total RNA with oligo-dT primer and Verso cDNA Synthesis Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. qPCR was performed by using Premix Ex Taq (Probe qPCR, Takara) and commercially available probes: ZSCAN4, Hs00537549_m1; MBD3L2, HS00544743_m1; DUX4, Hs03037970_g1; GAPDH, Hs99999905_m1; TRIM43, Hs00299174_m1; LEUTX, Hs01028718_m1; PRAMEF1, Hs04401269_sH; CCNA1, Hs00171105_m1; CDK1A, Hs00355782_m1; EGR1, Hs00152928_m1; Gapdh, Mm99999915_g1; Myo1g, Mm00617991-m1; Wfdc3, Mm01243777_m1; Zscan4c, Mm02581232_m1; Slc34a2, Mm01215846_m1; Pramef6, Mm01728753_g1; Tmem92, Mm01299147_m1; Usp17lb, Mm04214102_s1 (Applied Biosystems). Endogenous DUX4 expression in FSHD myoblast cell lines was detected by FAM-labeled probe (TCTCTGTGCCCTTGTTCTTCCGTGAA) and primers PLH298-PAS-F: CCCAGGTACCAGCAGACC and PLH395-PAS-R: TCCAGGTTTGCCTAGACAGCGTC, which target the 3′ splice and polyadenylation site (14). Gene expression levels were normalized to that of GAPDH and analyzed with 7500 System Software using the ∆∆CT method (Applied Biosystems). RNA-seq libraries were prepared using 500 ng of total RNA and the KAPA mRNA Hyper Prep Kit following the manufacturer’s instructions. Fifty–base paired end sequencing was performed on an Illumina NovaSeq instrument at the University of Minnesota Genomics Center.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.