To evaluate hedgehog pathway activation in NIH 3T3 cells, quantitative PCR (qPCR) assays were performed. Confluent cultures of NIH 3T3 cells were starved overnight in Dulbecco’s modified Eagle’s medium (DMEM) and treated for 24 hours with different concentrations of either rhShhN or ShhNC24II. Following incubation, RNA was extracted using the RNeasy Mini Kit (Qiagen) and reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen). Transcription of the mouse Gli1 gene was measured by qPCR using KAPA SYBR FAST (Sigma) on the LightCycler 480 System (Roche). mRNA expression of the SDHA gene was used for normalization. The data (as shown in Fig. 1B) were presented as fold enrichment with respect to the untreated sample. The sequences for the gene-specific primers were as follows: Gli1, GAATTCGTGTGCCATTGGGG (forward) and GGACTTCCGACAGCCTTCAA (reverse); SDHA, TTCCGTGTGGGGAGTGTATTGC (forward) and AGGTCTGTGTTCCAAACCATTCC (reverse). All qPCR experiments were performed in triplicate starting from independent cell cultures.

The luciferase assays were performed in PTCH1−/− MEFs (the cells were provided by M. P. Scott, Stanford University School of Medicine). In brief, PTCH1−/− MEFs were transfected using the TransIT-LT1 Transfection Reagent (catalog no. MIR2304). For transfection, cells were plated with the transfection mixture in 96-well plates. A mixture containing the plasmids encoding 8xGli-BS firefly luciferase (39) and cytomegalovirus (CMV)–Renilla luciferase (Promega), the latter constituting 110 of 8xGli-BS firefly luciferase plasmid, was added to the plasmids encoding the GFP, PTCH1, and PTCH1Δ constructs (1:1 with the luciferase plasmid mixture). At confluence, cells cultured in DMEM in the presence of 10 to 15% FCS were shifted to DMEM with 0.5% FCS and incubated for 48 hours. Cell lysates were prepared following the Dual-Glo Luciferase Assay System (Promega) protocol, and luciferase activity was measured using the GloMax Explorer Multimode Microplate Reader. For each sample, firefly luciferase values were normalized to the corresponding Renilla luciferase values to account for the differences in transfection efficiency between samples.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.