DNA was quantified fluorometrically using a Qubit with a double-stranded DNA high-sensitivity kit (Life Technologies). qPCR was performed using the custom primer dual indexed approach that targets the V4 hypervariable region of the 16S rRNA gene (58) using updated 16S rRNA gene primers 515F/806R (515F, 5′-GTGYCAGCMGCCGCGGTAA-3′; 806R, GGACTACNVGGGTWTCTAAT) that increase coverage of ammonia oxidizing archaea and other marine strains (59). To measure the abundance of amoA genes from archaea, the primers Arch amoA-1F (STAATGGTCTGGCTTAGACG) and Arch amoA-2R (GCGGCCATCCATCTGTATGT) were used (16). qPCR reactions were prepared using an automated liquid handler (pipetting robot). The epMotion 5070 (Eppendorf) was used to set up all qPCR reactions and standard curves as described previously (60). The efficiency values of the qPCR was <90%, and R2 values were >0.95%. qPCR was performed using white 96-well plates as this was found to increase the signal-to-noise ratio in the SYBR green assay twofold compared to clear plates. The technical variability of 16S rRNA gene qPCR measurements was determined to be consistently <5% using the epMotion 5070.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.