One week after nucleofection with HDR and targeting constructs, a minimum of 10,000 cells of the surviving cell population were collected for genomic phenotyping. DNA was extracted using the Genomic DNA Isolate Kit from Bioline (BIO52067). The DNA pellet was resuspended in ultrapurified water and used for PCR analysis. For PCR confirmation of Fab′ hybridoma, we used primer 1 (TGTAGGAGCTTGGGTCCAGA), which hybridizes the upstream of the 5′ homolog arm of the HDR template, and primer 2 (ATACATTGACACCAGTGAAGATGC), which hybridized with the Bsr gene. For confirmation of the integration of isotype constructs, we used primer 3 (GGCGACCTGTAACAACTTGG), annealing the upstream of the 5′ end of the HDR, and primer 2. PCR products were visualized on a 1% (w/v) agarose gel containing Nancy-520 dye stain. DNA was excised, purified (740609, Macherey-Nagel), and validated via Sanger sequencing.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.