Relative levels of the mutant and WT mtDNAs were quantified using a PyroMark Q24 pyrosequencer (Qiagen) (15). Briefly, this assay was developed using PyroMark assay design software v2.0 (Qiagen). A PCR reaction was performed to amplify a 178–base pair fragment containing the C5024T mutation site using a biotinylated forward primer and a nonbiotinylated reverse primer. After adding a PyroMark binding buffer (Qiagen) and 1 μl Streptavidin Sepharose TM high-performance beads (GE Healthcare), PCR products were purified and denaturated using a Pyromark Q24 vacuum workstation (Qiagen). Sequencing was carried out with PyroMark Gold Q24 Reagents according to manufacturer’s directions, using specific gene-sequencing primers 5′Biotin TTCCACCCTAGCTATCATAAGC (forward) and GTAGGTTTAATTCCTGCCAATCT (reverse) and the sequencing primer TGTAGGATGAAGTCTTACA.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.